Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Dimitri Bytchenkoff, Elisabetta Chiarparin, Dominique Früh, Simon Rüdisser, Geoffrey Bodenhausen

Research output: Contribution to journalArticlepeer-review


The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

Original languageEnglish (US)
Pages (from-to)377-379
Number of pages3
JournalMagnetic Resonance in Chemistry
Issue number5
StatePublished - May 1 2002
Externally publishedYes


  • Base-pair mobility
  • RNA
  • Scalar couplings across hydrogen bonds
  • Temperature-dependent couplings
  • Watson-Crick base pairs

ASJC Scopus subject areas

  • Chemistry(all)
  • Materials Science(all)


Dive into the research topics of 'Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA'. Together they form a unique fingerprint.

Cite this