Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Dimitri Bytchenkoff, Elisabetta Chiarparin, Dominique P Frueh, Simon Rüdisser, Geoffrey Bodenhausen

Research output: Contribution to journalArticle

Abstract

The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

Original languageEnglish (US)
Pages (from-to)377-379
Number of pages3
JournalMagnetic Resonance in Chemistry
Volume40
Issue number5
DOIs
StatePublished - May 1 2002
Externally publishedYes

Fingerprint

Uracil
Adenine
RNA
Nitrogen
Cytosine
Guanine
uracil
scalars
adenines
nitrogen
temperature dependence
guanines
Chemical shift
Nucleotides
Oligomers
Temperature
Hydrogen bonds
Modulation
nucleotides
oligomers

Keywords

  • Base-pair mobility
  • RNA
  • Scalar couplings across hydrogen bonds
  • Temperature-dependent couplings
  • Watson-Crick base pairs

ASJC Scopus subject areas

  • Chemistry(all)
  • Physical and Theoretical Chemistry
  • Spectroscopy

Cite this

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA. / Bytchenkoff, Dimitri; Chiarparin, Elisabetta; Frueh, Dominique P; Rüdisser, Simon; Bodenhausen, Geoffrey.

In: Magnetic Resonance in Chemistry, Vol. 40, No. 5, 01.05.2002, p. 377-379.

Research output: Contribution to journalArticle

Bytchenkoff, Dimitri ; Chiarparin, Elisabetta ; Frueh, Dominique P ; Rüdisser, Simon ; Bodenhausen, Geoffrey. / Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA. In: Magnetic Resonance in Chemistry. 2002 ; Vol. 40, No. 5. pp. 377-379.
@article{6684be06ecd4404d8afbca16ec3215fd,
title = "Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA",
abstract = "The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.",
keywords = "Base-pair mobility, RNA, Scalar couplings across hydrogen bonds, Temperature-dependent couplings, Watson-Crick base pairs",
author = "Dimitri Bytchenkoff and Elisabetta Chiarparin and Frueh, {Dominique P} and Simon R{\"u}disser and Geoffrey Bodenhausen",
year = "2002",
month = "5",
day = "1",
doi = "10.1002/mrc.1018",
language = "English (US)",
volume = "40",
pages = "377--379",
journal = "Magnetic Resonance in Chemistry",
issn = "0749-1581",
publisher = "John Wiley and Sons Ltd",
number = "5",

}

TY - JOUR

T1 - Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

AU - Bytchenkoff, Dimitri

AU - Chiarparin, Elisabetta

AU - Frueh, Dominique P

AU - Rüdisser, Simon

AU - Bodenhausen, Geoffrey

PY - 2002/5/1

Y1 - 2002/5/1

N2 - The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

AB - The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

KW - Base-pair mobility

KW - RNA

KW - Scalar couplings across hydrogen bonds

KW - Temperature-dependent couplings

KW - Watson-Crick base pairs

UR - http://www.scopus.com/inward/record.url?scp=0037935797&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0037935797&partnerID=8YFLogxK

U2 - 10.1002/mrc.1018

DO - 10.1002/mrc.1018

M3 - Article

VL - 40

SP - 377

EP - 379

JO - Magnetic Resonance in Chemistry

JF - Magnetic Resonance in Chemistry

SN - 0749-1581

IS - 5

ER -