Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Dimitri Bytchenkoff; Elisabetta Chiarparin; Dominique Früh; Simon Rüdisser; Geoffrey Bodenhausen

doi:10.1002/mrc.1018

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Dimitri Bytchenkoff, Elisabetta Chiarparin, Dominique Früh, Simon Rüdisser, Geoffrey Bodenhausen

Research output: Contribution to journal › Article › peer-review

9 Scopus citations

Abstract

The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings ^2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of ^2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of ^2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

Original language	English (US)
Pages (from-to)	377-379
Number of pages	3
Journal	Magnetic Resonance in Chemistry
Volume	40
Issue number	5
DOIs	https://doi.org/10.1002/mrc.1018
State	Published - May 1 2002
Externally published	Yes

Keywords

Base-pair mobility
RNA
Scalar couplings across hydrogen bonds
Temperature-dependent couplings
Watson-Crick base pairs

ASJC Scopus subject areas

General Chemistry
General Materials Science

Access to Document

10.1002/mrc.1018

Cite this

@article{6684be06ecd4404d8afbca16ec3215fd,

title = "Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA",

abstract = "The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.",

keywords = "Base-pair mobility, RNA, Scalar couplings across hydrogen bonds, Temperature-dependent couplings, Watson-Crick base pairs",

author = "Dimitri Bytchenkoff and Elisabetta Chiarparin and Dominique Fr{\"u}h and Simon R{\"u}disser and Geoffrey Bodenhausen",

year = "2002",

month = may,

day = "1",

doi = "10.1002/mrc.1018",

language = "English (US)",

volume = "40",

pages = "377--379",

journal = "Magnetic Resonance in Chemistry",

issn = "0749-1581",

publisher = "John Wiley and Sons Ltd",

number = "5",

}

TY - JOUR

T1 - Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

AU - Bytchenkoff, Dimitri

AU - Chiarparin, Elisabetta

AU - Früh, Dominique

AU - Rüdisser, Simon

AU - Bodenhausen, Geoffrey

PY - 2002/5/1

Y1 - 2002/5/1

N2 - The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

AB - The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates.

KW - Base-pair mobility

KW - RNA

KW - Scalar couplings across hydrogen bonds

KW - Temperature-dependent couplings

KW - Watson-Crick base pairs

UR - http://www.scopus.com/inward/record.url?scp=0037935797&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0037935797&partnerID=8YFLogxK

U2 - 10.1002/mrc.1018

DO - 10.1002/mrc.1018

M3 - Article

AN - SCOPUS:0037935797

SN - 0749-1581

VL - 40

SP - 377

EP - 379

JO - Magnetic Resonance in Chemistry

JF - Magnetic Resonance in Chemistry

IS - 5

ER -

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Abstract

Keywords

ASJC Scopus subject areas

Access to Document

Other files and links

Fingerprint

Cite this